fRNAdb - Detail Page [FR060027]

FR060027

Summary
Sequence
Secondary Structure

Evidence Mapping [EvoFold]

extracted from EvoFold track on Genome Browser@hg18

Summary
ID	FR060027
Description	Putative conserved noncoding region (EvoFold)
Accession
Sequence Ontology	nc_conserved_region
Organism
Homo sapiens	human , man
Genome Mapping
human(hg18) 1 region	chr17:25468227-25468307(+)
Cross Reference
RNAdb v2.0	EVF42704
Gene Association / Sense Overlap / Intron
human(hg18)	CCDC55 (uc002heu.1 , uc002hev.1 )
Gene Association / Sense Overlap / 3'UTR
human(hg18)	CS266996 (uc002hew.1 )
Sequence Similarity

MicroArray / Affymetrix GeneChip Exon Array / hg18
Probe	Transcript Cluster	Probe Locus
3936752	3716337	chr17:25468246-25468270(+)

MicroArray / Invitrogen Ncode Noncoding RNA Array / hg18
Probe	Target Transcript	Probe Locus
IVGNh30660	UC002HEW	chr17:25468222-25468282(+)

Reference
Identification and classification of conserved RNA secondary structures in the human genome. Pedersen JS.,Bejerano G.,Siepel A.,Rosenbloom K.,Lindblad-Toh K.,Lander ES.,Kent J.,Miller W. and Haussler D. PLoS Comput Biol 2 (4), e33 (2006) RNAdb--a comprehensive mammalian noncoding RNA database. Pang KC.,Stephen S.,Engström PG.,Tajul-Arifin K.,Chen W.,Wahlestedt C.,Lenhard B.,Hayashizaki Y. and Mattick JS. Nucleic Acids Res 33 (Database issue), D125-30 (2005)

Reference

Identification and classification of conserved RNA secondary structures in the human genome.
Pedersen JS.,Bejerano G.,Siepel A.,Rosenbloom K.,Lindblad-Toh K.,Lander ES.,Kent J.,Miller W. and Haussler D.
PLoS Comput Biol 2 (4), e33 (2006)

RNAdb--a comprehensive mammalian noncoding RNA database.
Pang KC.,Stephen S.,Engström PG.,Tajul-Arifin K.,Chen W.,Wahlestedt C.,Lenhard B.,Hayashizaki Y. and Mattick JS.
Nucleic Acids Res 33 (Database issue), D125-30 (2005)

Evidence :

Evidence Secondary Structure [putative(EvoFold)]

Putative secondary structure predicted by EvoFold.

Click here to view the PDF file.

0         1         2         3         4         5         6
AGGAAGUUAGGCUGAGGGGCAGAGAGCGAGACUUUUCUAUUUUCCAAAAGCUCGGUCUGAGGCCCCUCAG
(((((((.((((((((((((..(((.((((.(((((.........))))))))).)))...)))))))))

7         8
UCUUGCUUCCU
))).)))))))

[Return]