FR116078

[Return]
  • Summary
  • Sequence
  • Secondary Structure

Evidence Secondary Structure [putative(similarity)]
Putative secondary structure predicted from structure of similar sequence.

Click here to view the PDF file.

0         1         2         3         4         5         6
UGGAUCGAUGAUGACUACCGGUGGCGUAUGAGUCAUAUGUGAUGAAUACGUGUUUGGAACUCUGAGGUCC
.(((((...........................................................)))))

7
A
.

[Return]