fRNAdb - Detail Page [FR116078]

FR116078

Summary
Sequence
Secondary Structure

Evidence Mapping [blat]

blat with identity=99, coverage=90 and no-repeat

Evidence Sequence Similarity [highly similar]

Almost same sequences with one mismatch or one gap

Summary
ID	FR116078
Description	C/D box small nucleolar RNA (snoRNA) 14q(II-22) / SNORD114-22
Accession	NR_003215
Sequence Ontology	C_D_box_snoRNA
Organism
Homo sapiens	human , man
Genome Mapping
human(hg18) 1 region	chr14:100519016-100519086(+)
Cross Reference
snoRNA-LBME-db release3	14q(II-22)
RNAdb v2.0	SNO1249
Gene Association / Sense Overlap / 3'UTR
human(hg18)	NR_003215 (uc001yjm.1 )
Sequence Similarity
highly similar	FR342550 C/D box guide small nucleolar RNA (snoRNA) SNORD113 / SNORD114

MicroArray / Invitrogen Ncode Noncoding RNA Array / hg18
Probe	Target Transcript	Probe Locus
IVGNh29266	UC001YJM	chr14:100519021-100519081(+)

Reference
snoRNA-LBME-db, a comprehensive database of human H/ACA and C/D box snoRNAs. Lestrade L. and Weber MJ. Nucleic Acids Res 34 (Database issue), D158-62 (2006) RNAdb--a comprehensive mammalian noncoding RNA database. Pang KC.,Stephen S.,Engström PG.,Tajul-Arifin K.,Chen W.,Wahlestedt C.,Lenhard B.,Hayashizaki Y. and Mattick JS. Nucleic Acids Res 33 (Database issue), D125-30 (2005) Identification of tandemly-repeated C/D snoRNA genes at the imprinted human 14q32 domain reminiscent of those at the Prader-Willi/Angelman syndrome region. Cavaillé J.,Seitz H.,Paulsen M.,Ferguson-Smith AC. and Bachellerie JP. Hum Mol Genet 11 (13), 1527-38 (2002)

Reference

snoRNA-LBME-db, a comprehensive database of human H/ACA and C/D box snoRNAs.
Lestrade L. and Weber MJ.
Nucleic Acids Res 34 (Database issue), D158-62 (2006)

RNAdb--a comprehensive mammalian noncoding RNA database.
Pang KC.,Stephen S.,Engström PG.,Tajul-Arifin K.,Chen W.,Wahlestedt C.,Lenhard B.,Hayashizaki Y. and Mattick JS.
Nucleic Acids Res 33 (Database issue), D125-30 (2005)

Identification of tandemly-repeated C/D snoRNA genes at the imprinted human 14q32 domain reminiscent of those at the Prader-Willi/Angelman syndrome region.
Cavaillé J.,Seitz H.,Paulsen M.,Ferguson-Smith AC. and Bachellerie JP.
Hum Mol Genet 11 (13), 1527-38 (2002)

Evidence :

Evidence Secondary Structure [putative(similarity)]

Putative secondary structure predicted from structure of similar sequence.

Click here to view the PDF file.

0         1         2         3         4         5         6
UGGAUCGAUGAUGACUACCGGUGGCGUAUGAGUCAUAUGUGAUGAAUACGUGUUUGGAACUCUGAGGUCC
.(((((...........................................................)))))

7
A
.

[Return]