fRNAdb - Detail Page [FR135353]

FR135353

Summary
Sequence
Secondary Structure

Evidence Mapping [blat]

blat with identity=99, coverage=90 and no-repeat

Evidence Sequence Similarity [highly similar]

Almost same sequences with one mismatch or one gap

Summary
ID	FR135353
Description	precursor micro RNA (miRNA) mir-181a-1
Accession
Sequence Ontology	pre_miRNA
Organism
Homo sapiens	human , man
Lagothrix lagotricha	Humboldt's woolly monkey , Lagothrix lagothricha , common woolly monkey
Macaca mulatta	rhesus macaque , rhesus macaques , rhesus monkey , rhesus monkeys
Macaca nemestrina	pig-tailed macaque , pigtail macaque , pigtail monkey
Pan paniscus	bonobo , pygmy chimpanzee
Pan troglodytes	Chimpansee troglodytes , chimpanzee
Pongo pygmaeus	orang-utan , orangutan
Genome Mapping
human(hg18) 1 region	chr1:197094796-197094905(-)
Cross Reference
miRBase v9.2	MI0002935 MI0002941 MI0002939 MI0000289 MI0002933 MI0002943 MI0002931
Gene Association / Sense Overlap / 5'UTR
human(hg18)	DJ027059 (uc001guy.1 )
Sequence Similarity
highly similar	FR160982 precursor micro RNA (miRNA) mir-181a-1

MicroArray / Affymetrix GeneChip Exon Array / hg18
Probe	Transcript Cluster	Probe Locus
4618397	2450000	chr1:197094796-197094820(-)
5573981	2450000	chr1:197094808-197094832(-)
2202623	2450000	chr1:197094818-197094842(-)
1364837	2450000	chr1:197094834-197094858(-)

Reference
Phylogenetic shadowing and computational identification of human microRNA genes. Berezikov E.,Guryev V.,van de Belt J.,Wienholds E.,Plasterk RH. and Cuppen E. Cell 120 (1), 21-4 (2005) New human and mouse microRNA genes found by homology search. Weber MJ. FEBS J 272 (1), 59-73 (2005) Vertebrate microRNA genes. Lim LP.,Glasner ME.,Yekta S.,Burge CB. and Bartel DP. Science 299 (5612), 1540 (2003) Numerous microRNPs in neuronal cells containing novel microRNAs. Dostie J.,Mourelatos Z.,Yang M.,Sharma A. and Dreyfuss G. RNA 9 (2), 180-6 (2003)

Reference

Phylogenetic shadowing and computational identification of human microRNA genes.
Berezikov E.,Guryev V.,van de Belt J.,Wienholds E.,Plasterk RH. and Cuppen E.
Cell 120 (1), 21-4 (2005)

New human and mouse microRNA genes found by homology search.
Weber MJ.
FEBS J 272 (1), 59-73 (2005)

Vertebrate microRNA genes.
Lim LP.,Glasner ME.,Yekta S.,Burge CB. and Bartel DP.
Science 299 (5612), 1540 (2003)

Numerous microRNPs in neuronal cells containing novel microRNAs.
Dostie J.,Mourelatos Z.,Yang M.,Sharma A. and Dreyfuss G.
RNA 9 (2), 180-6 (2003)

Phylogenetic shadowing and computational identification of human microRNA genes.
Berezikov E.,Guryev V.,van de Belt J.,Wienholds E.,Plasterk RH. and Cuppen E.
Cell 120 (1), 21-4 (2005)

New human and mouse microRNA genes found by homology search.
Weber MJ.
FEBS J 272 (1), 59-73 (2005)

Vertebrate microRNA genes.
Lim LP.,Glasner ME.,Yekta S.,Burge CB. and Bartel DP.
Science 299 (5612), 1540 (2003)

Numerous microRNPs in neuronal cells containing novel microRNAs.
Dostie J.,Mourelatos Z.,Yang M.,Sharma A. and Dreyfuss G.
RNA 9 (2), 180-6 (2003)

from to notation

>FR135353||precursor micro RNA (miRNA) mir-181a-1|pre_miRNA|MI0000289 miRBase v9.2,MI0002931 miRBase v9.2,MI0002933 miRBase v9.2,MI0002935 miRBase v9.2,MI0002939 miRBase v9.2,MI0002941 miRBase v9.2,MI0002943 miRBase v9.2|Homo sapiens,Lagothrix lagotricha,Macaca mulatta,Macaca nemestrina,Pan paniscus,Pan troglodytes,Pongo pygmaeus|110nt
TGAGTTTTGAGGTTGCTTCAGTGAACATTCAACGCTGTCGGTGAGTTTGGAATTAAAATCAAAACCATCG
ACCGTTGATTGTACCCTATGGCTAACCATCATCTACTCCA

Evidence : putative(miRBase)

Evidence Secondary Structure [putative(miRBase)]

Putative secondary structure predicted by miRBase.

Click here to view the PDF file.

0         1         2         3         4         5         6
UGAGUUUUGAGGUUGCUUCAGUGAACAUUCAACGCUGUCGGUGAGUUUGGAAUUAAAAUCAAAACCAUCG
.((((..((((((((((..((.(.(((.((((((..(((((((.((((.((.......)).)))))))))

7         8         9         0
ACCGUUGAUUGUACCCUAUGGCUAACCAUCAUCUACUCCA
)))))))).))).).))..))).)))).)))...))))..

Experiment	Method	Tissue	Read Number	PubMed

[Return]