FR138534
- Summary
- Sequence
- Secondary Structure
| Summary | |
|---|---|
| ID | FR138534 |
| Description | C/D box guide small nucleolar RNA (snoRNA) SNORD48 / U48 |
| Accession | AL671762 , X96648 |
| Sequence Ontology | C_D_box_snoRNA |
| Organism | |
| Genome Mapping | |
| human(hg18) 1 region | chr6:31911019-31911082(+)  |
| Cross Reference | |
| Gene Association / Sense Overlap / Intron | |
| human(hg18) | C6orf48 (uc003nxl.1 , uc003nxm.1 , uc003nxn.1 ) |
| Gene Association / Sense Overlap / 3'UTR | |
| human(hg18) | NR_002745 (uc003nxo.1 ) |
| Gene Association / Transcription Neighbor / upstream | |
| human(hg18) | NR_002742 (uc003nxp.1 ) |
| Sequence Similarity | |
| highly similar |
FR385465 C/D box guide small nucleolar RNA (snoRNA) SNORD48 / U48 |
| OMIM | ||
|---|---|---|
| ID | Title | Locus |
| 605447 | G8 PROTEIN G8 |
6p21.3(chr6:29900001-36800000) |
| MicroArray / Invitrogen Ncode Noncoding RNA Array / hg18 | ||
|---|---|---|
| Probe | Target Transcript | Probe Locus |
| IVGNh36364 | UC003NXO |
chr6:31911018-31911078(+) |
| Reference | |
|---|---|
|
snoRNA-LBME-db, a comprehensive database of human H/ACA and C/D box snoRNAs.
Lestrade L. and Weber MJ. Nucleic Acids Res 34 (Database issue), D158-62 (2006)
RNAdb--a comprehensive mammalian noncoding RNA database.
Pang KC.,Stephen S.,Engström PG.,Tajul-Arifin K.,Chen W.,Wahlestedt C.,Lenhard B.,Hayashizaki Y. and Mattick JS. Nucleic Acids Res 33 (Database issue), D125-30 (2005)
Purified box C/D snoRNPs are able to reproduce site-specific 2'-O-methylation of target RNA in vitro.
Galardi S.,Fatica A.,Bachi A.,Scaloni A.,Presutti C. and Bozzoni I. Mol Cell Biol 22 (19), 6663-8 (2002)
Site-specific ribose methylation of preribosomal RNA: a novel function for small nucleolar RNAs.
Kiss-László Z.,Henry Y.,Bachellerie JP.,Caizergues-Ferrer M. and Kiss T. Cell 85 (7), 1077-88 (1996)
The numerous modified nucleotides in eukaryotic ribosomal RNA.
Maden BE. Prog Nucleic Acid Res Mol Biol 39 (), 241-303 (1990) | |
snoRNA-LBME-db, a comprehensive database of human H/ACA and C/D box snoRNAs.
Lestrade L. and Weber MJ.
Nucleic Acids Res 34 (Database issue), D158-62 (2006)
Lestrade L. and Weber MJ.
Nucleic Acids Res 34 (Database issue), D158-62 (2006)
RNAdb--a comprehensive mammalian noncoding RNA database.
Pang KC.,Stephen S.,Engström PG.,Tajul-Arifin K.,Chen W.,Wahlestedt C.,Lenhard B.,Hayashizaki Y. and Mattick JS.
Nucleic Acids Res 33 (Database issue), D125-30 (2005)
Pang KC.,Stephen S.,Engström PG.,Tajul-Arifin K.,Chen W.,Wahlestedt C.,Lenhard B.,Hayashizaki Y. and Mattick JS.
Nucleic Acids Res 33 (Database issue), D125-30 (2005)
Purified box C/D snoRNPs are able to reproduce site-specific 2'-O-methylation of target RNA in vitro.
Galardi S.,Fatica A.,Bachi A.,Scaloni A.,Presutti C. and Bozzoni I.
Mol Cell Biol 22 (19), 6663-8 (2002)
Galardi S.,Fatica A.,Bachi A.,Scaloni A.,Presutti C. and Bozzoni I.
Mol Cell Biol 22 (19), 6663-8 (2002)
Site-specific ribose methylation of preribosomal RNA: a novel function for small nucleolar RNAs.
Kiss-László Z.,Henry Y.,Bachellerie JP.,Caizergues-Ferrer M. and Kiss T.
Cell 85 (7), 1077-88 (1996)
Kiss-László Z.,Henry Y.,Bachellerie JP.,Caizergues-Ferrer M. and Kiss T.
Cell 85 (7), 1077-88 (1996)
The numerous modified nucleotides in eukaryotic ribosomal RNA.
Maden BE.
Prog Nucleic Acid Res Mol Biol 39 (), 241-303 (1990)
Maden BE.
Prog Nucleic Acid Res Mol Biol 39 (), 241-303 (1990)
>FR138534|AL671762,X96648|C/D box guide small nucleolar RNA (snoRNA) SNORD48 / U48|C_D_box_snoRNA|RF00282 Rfam v8.1,SNO1437 RNAdb v2.0,U48 snoRNA-LBME-db release3|Homo sapiens|64nt AGTGATGATGACCCCAGGTAACTCTTGAGTGTGTCGCTGATGCCATCACCGCAGCGCTCTGACC
Evidence : putative(Rfam)
Evidence Secondary Structure [putative(Rfam)]
Putative secondary structure predicted by Rfam.
0 1 2 3 4 5 6 AGUGAUGAUGACCCCAGGUAACUCUUGAGUGUGUCGCUGAUGCCAUCACCGCAGCGCUCUGACC ((............................................................))
| Experiment | Method | Tissue | Read Number | PubMed |
|---|