FR168977
- Summary
- Sequence
- Secondary Structure
| Summary | |
|---|---|
| ID | FR168977 |
| Description | C/D box guide small nucleolar RNA (snoRNA) Z12 |
| Accession | AJ010676 |
| Sequence Ontology | C_D_box_snoRNA |
| Organism | |
| Genome Mapping | |
| Cross Reference | |
| Sequence Similarity | |
| highly similar |
FR387094 C/D box guide small nucleolar RNA (snoRNA) Z12 |
| Reference | |
|---|---|
|
NONCODE: an integrated knowledge database of non-coding RNAs.
Liu C.,Bai B.,Skogerbø G.,Cai L.,Deng W.,Zhang Y.,Bu D.,Zhao Y. and Chen R. Nucleic Acids Res 33 (Database issue), D112-5 (2005)
Identification of 13 novel human modification guide RNAs.
Vitali P.,Royo H.,Seitz H.,Bachellerie JP.,Hüttenhofer A. and Cavaillé J. Nucleic Acids Res 31 (22), 6543-51 (2003)
Purified box C/D snoRNPs are able to reproduce site-specific 2'-O-methylation of target RNA in vitro.
Galardi S.,Fatica A.,Bachi A.,Scaloni A.,Presutti C. and Bozzoni I. Mol Cell Biol 22 (19), 6663-8 (2002)
Archaeal homologs of eukaryotic methylation guide small nucleolar RNAs: lessons from the Pyrococcus genomes.
Gaspin C.,Cavaillé J.,Erauso G. and Bachellerie JP. J Mol Biol 297 (4), 895-906 (2000)
The RNA world of the nucleolus: two major families of small RNAs defined by different box elements with related functions.
Balakin AG.,Smith L. and Fournier MJ. Cell 86 (5), 823-34 (1996) | |
NONCODE: an integrated knowledge database of non-coding RNAs.
Liu C.,Bai B.,Skogerbø G.,Cai L.,Deng W.,Zhang Y.,Bu D.,Zhao Y. and Chen R.
Nucleic Acids Res 33 (Database issue), D112-5 (2005)
Liu C.,Bai B.,Skogerbø G.,Cai L.,Deng W.,Zhang Y.,Bu D.,Zhao Y. and Chen R.
Nucleic Acids Res 33 (Database issue), D112-5 (2005)
Identification of 13 novel human modification guide RNAs.
Vitali P.,Royo H.,Seitz H.,Bachellerie JP.,Hüttenhofer A. and Cavaillé J.
Nucleic Acids Res 31 (22), 6543-51 (2003)
Vitali P.,Royo H.,Seitz H.,Bachellerie JP.,Hüttenhofer A. and Cavaillé J.
Nucleic Acids Res 31 (22), 6543-51 (2003)
Purified box C/D snoRNPs are able to reproduce site-specific 2'-O-methylation of target RNA in vitro.
Galardi S.,Fatica A.,Bachi A.,Scaloni A.,Presutti C. and Bozzoni I.
Mol Cell Biol 22 (19), 6663-8 (2002)
Galardi S.,Fatica A.,Bachi A.,Scaloni A.,Presutti C. and Bozzoni I.
Mol Cell Biol 22 (19), 6663-8 (2002)
Archaeal homologs of eukaryotic methylation guide small nucleolar RNAs: lessons from the Pyrococcus genomes.
Gaspin C.,Cavaillé J.,Erauso G. and Bachellerie JP.
J Mol Biol 297 (4), 895-906 (2000)
Gaspin C.,Cavaillé J.,Erauso G. and Bachellerie JP.
J Mol Biol 297 (4), 895-906 (2000)
The RNA world of the nucleolus: two major families of small RNAs defined by different box elements with related functions.
Balakin AG.,Smith L. and Fournier MJ.
Cell 86 (5), 823-34 (1996)
Balakin AG.,Smith L. and Fournier MJ.
Cell 86 (5), 823-34 (1996)
>FR168977|AJ010676|C/D box guide small nucleolar RNA (snoRNA) Z12|C_D_box_snoRNA|u1995 NONCODE v1.0,RF00289 Rfam v8.1|Homo sapiens|70nt GCTGTGATGACATTCCAATTAAAGCACGTGTTAGACTTCTGACGCGGGTGATGCGAACTGGAGTCTGAGC
Evidence : putative(Rfam)
Evidence Secondary Structure [putative(Rfam)]
Putative secondary structure predicted by Rfam.
0 1 2 3 4 5 6 GCUGUGAUGACAUUCCAAUUAAAGCACGUGUUAGACUUCUGACGCGGGUGAUGCGAACUGGAGUCUGAGC ((..................................................................))
| Experiment | Method | Tissue | Read Number | PubMed |
|---|