FR174725

[Return]
  • Summary
  • Sequence
  • Secondary Structure

Evidence Secondary Structure [putative(miRBase)]
Putative secondary structure predicted by miRBase.

Click here to view the PDF file.

0         1         2         3         4         5         6
ACUGCUAACGAAUGCUCUGACUUUAUUGCACUACUGUACUUUACAGCUAGCAGUGCAAUAGUAUUGUCAA
.(((((..((.(((((.((((.((((((((((.((((((.)))))).....))))))))))....)))).

7         8
AGCAUCUGAAAGCAGG
))))).))..))))).

[Return]