FR217284

[Return]
  • Summary
  • Sequence
  • Secondary Structure

Evidence Secondary Structure [putative(EvoFold)]
Putative secondary structure predicted by EvoFold.

Click here to view the PDF file.

0         1         2         3         4         5         6
AGAAAUUCCCCAAGUUUGGGGUGAGGUGGGAACCAUGUAAAUAUGUGAGAUAUGUACACACUGGCGGGGA
((((((((((((....)))))......(((((.((((((((((((((.........))))..........

7         8         9         0         1         2         3
GAAGAAACAUUUUGUGCUUGGUUUUUAUUUUUGGUUUUCCGGGUUACCCUUCCUUCCUACCCUAAAGGAU
......(((...)))......((((..((((....(((.........................)))((((

4         5         6         7         8         9
UUUGUACACUGACUAAUCCGAAAAAGAUAUUUUAAUAUGAUUUCCGAAUUUCU
(.............))))))))))))))))))..))))).))))).)))))))

[Return]