fRNAdb - Detail Page [FR251020]

FR251020

Summary
Sequence
Secondary Structure

Evidence Mapping [blat]

blat with identity=99, coverage=90 and no-repeat

Summary
ID	FR251020
Description	C/D box guide small nucleolar RNA (snoRNA) HBII-52-48 / SNORD115-48
Accession	AC100774 , AF250841 , NR_003362
Sequence Ontology	C_D_box_snoRNA
Organism
Homo sapiens	human , man
Genome Mapping
human(hg18) 1 region	chr15:23066023-23066098(+)
Cross Reference
Rfam v8.1	RF00105
NONCODE v1.0	u1093
snoRNA-LBME-db release3	HBII-52-48
Gene Association / Sense Overlap / Intron
human(hg18)	AF400500 (uc001zan.1 ), AF400501 (uc001zae.2 )
Gene Association / Sense Overlap / 3'UTR
human(hg18)	NR_003362 (uc001zao.1 )
Sequence Similarity

Reference
The snoRNA HBII-52 regulates alternative splicing of the serotonin receptor 2C. Kishore S. and Stamm S. Science 311 (5758), 230-2 (2006) snoRNA-LBME-db, a comprehensive database of human H/ACA and C/D box snoRNAs. Lestrade L. and Weber MJ. Nucleic Acids Res 34 (Database issue), D158-62 (2006) ADAR2-mediated editing of RNA substrates in the nucleolus is inhibited by C/D small nucleolar RNAs. Vitali P.,Basyuk E.,Le Meur E.,Bertrand E.,Muscatelli F.,Cavaillé J. and Huttenhofer A. J Cell Biol 169 (5), 745-53 (2005) Exclusion of the C/D box snoRNA gene cluster HBII-52 from a major role in Prader-Willi syndrome. Runte M.,Varon R.,Horn D.,Horsthemke B. and Buiting K. Hum Genet 116 (3), 228-30 (2005) NONCODE: an integrated knowledge database of non-coding RNAs. Liu C.,Bai B.,Skogerbø G.,Cai L.,Deng W.,Zhang Y.,Bu D.,Zhao Y. and Chen R. Nucleic Acids Res 33 (Database issue), D112-5 (2005) Identification of tandemly-repeated C/D snoRNA genes at the imprinted human 14q32 domain reminiscent of those at the Prader-Willi/Angelman syndrome region. Cavaillé J.,Seitz H.,Paulsen M.,Ferguson-Smith AC. and Bachellerie JP. Hum Mol Genet 11 (13), 1527-38 (2002) The IC-SNURF-SNRPN transcript serves as a host for multiple small nucleolar RNA species and as an antisense RNA for UBE3A. Runte M.,Hüttenhofer A.,Gross S.,Kiefmann M.,Horsthemke B. and Buiting K. Hum Mol Genet 10 (23), 2687-700 (2001) Identification of brain-specific and imprinted small nucleolar RNA genes exhibiting an unusual genomic organization. Cavaillé J.,Buiting K.,Kiefmann M.,Lalande M.,Brannan CI.,Horsthemke B.,Bachellerie JP.,Brosius J. and Hüttenhofer A. Proc Natl Acad Sci U S A 97 (26), 14311-6 (2000) Archaeal homologs of eukaryotic methylation guide small nucleolar RNAs: lessons from the Pyrococcus genomes. Gaspin C.,Cavaillé J.,Erauso G. and Bachellerie JP. J Mol Biol 297 (4), 895-906 (2000) The RNA world of the nucleolus: two major families of small RNAs defined by different box elements with related functions. Balakin AG.,Smith L. and Fournier MJ. Cell 86 (5), 823-34 (1996)

Reference

The snoRNA HBII-52 regulates alternative splicing of the serotonin receptor 2C.
Kishore S. and Stamm S.
Science 311 (5758), 230-2 (2006)

snoRNA-LBME-db, a comprehensive database of human H/ACA and C/D box snoRNAs.
Lestrade L. and Weber MJ.
Nucleic Acids Res 34 (Database issue), D158-62 (2006)

ADAR2-mediated editing of RNA substrates in the nucleolus is inhibited by C/D small nucleolar RNAs.
Vitali P.,Basyuk E.,Le Meur E.,Bertrand E.,Muscatelli F.,Cavaillé J. and Huttenhofer A.
J Cell Biol 169 (5), 745-53 (2005)

Exclusion of the C/D box snoRNA gene cluster HBII-52 from a major role in Prader-Willi syndrome.
Runte M.,Varon R.,Horn D.,Horsthemke B. and Buiting K.
Hum Genet 116 (3), 228-30 (2005)

NONCODE: an integrated knowledge database of non-coding RNAs.
Liu C.,Bai B.,Skogerbø G.,Cai L.,Deng W.,Zhang Y.,Bu D.,Zhao Y. and Chen R.
Nucleic Acids Res 33 (Database issue), D112-5 (2005)

Identification of tandemly-repeated C/D snoRNA genes at the imprinted human 14q32 domain reminiscent of those at the Prader-Willi/Angelman syndrome region.
Cavaillé J.,Seitz H.,Paulsen M.,Ferguson-Smith AC. and Bachellerie JP.
Hum Mol Genet 11 (13), 1527-38 (2002)

The IC-SNURF-SNRPN transcript serves as a host for multiple small nucleolar RNA species and as an antisense RNA for UBE3A.
Runte M.,Hüttenhofer A.,Gross S.,Kiefmann M.,Horsthemke B. and Buiting K.
Hum Mol Genet 10 (23), 2687-700 (2001)

Identification of brain-specific and imprinted small nucleolar RNA genes exhibiting an unusual genomic organization.
Cavaillé J.,Buiting K.,Kiefmann M.,Lalande M.,Brannan CI.,Horsthemke B.,Bachellerie JP.,Brosius J. and Hüttenhofer A.
Proc Natl Acad Sci U S A 97 (26), 14311-6 (2000)

Archaeal homologs of eukaryotic methylation guide small nucleolar RNAs: lessons from the Pyrococcus genomes.
Gaspin C.,Cavaillé J.,Erauso G. and Bachellerie JP.
J Mol Biol 297 (4), 895-906 (2000)

The RNA world of the nucleolus: two major families of small RNAs defined by different box elements with related functions.
Balakin AG.,Smith L. and Fournier MJ.
Cell 86 (5), 823-34 (1996)

The snoRNA HBII-52 regulates alternative splicing of the serotonin receptor 2C.
Kishore S. and Stamm S.
Science 311 (5758), 230-2 (2006)

snoRNA-LBME-db, a comprehensive database of human H/ACA and C/D box snoRNAs.
Lestrade L. and Weber MJ.
Nucleic Acids Res 34 (Database issue), D158-62 (2006)

Exclusion of the C/D box snoRNA gene cluster HBII-52 from a major role in Prader-Willi syndrome.
Runte M.,Varon R.,Horn D.,Horsthemke B. and Buiting K.
Hum Genet 116 (3), 228-30 (2005)

NONCODE: an integrated knowledge database of non-coding RNAs.
Liu C.,Bai B.,Skogerbø G.,Cai L.,Deng W.,Zhang Y.,Bu D.,Zhao Y. and Chen R.
Nucleic Acids Res 33 (Database issue), D112-5 (2005)

The RNA world of the nucleolus: two major families of small RNAs defined by different box elements with related functions.
Balakin AG.,Smith L. and Fournier MJ.
Cell 86 (5), 823-34 (1996)

Evidence :

Evidence Secondary Structure [putative(Rfam)]

Putative secondary structure predicted by Rfam.

Click here to view the PDF file.

0         1         2         3         4         5         6
GGGUCAAUGAUGAGAUGUUACCUUGAAGAGAAAUGAUGACGUAAAAAUUAAGUUCAGUUGGAUUACGCUG
(((((((((........................................................)))))

7
AGGCCC
..))))

[Return]