FR266414

[Return]
  • Summary
  • Sequence
  • Secondary Structure

Evidence Secondary Structure [putative(CentroidAlign)]
Putative secondary structure predicted by CentroidAlign.

Click here to view the PDF file.

offset      0         1         2         3         4         5         6
FR266414    UGUCAGGAGCCACCUUCCGAGCCUCCAGUACCACGUGUCAGG-GCCACAUGAGCUGGGCCUCGUGGGCCU
rheMac2     UGCCAGGAGCCACCUUCCGAGCCUCCAGUACCACGUGUCAGG-GCCACAUGAGCUGGGCCUCGUGGGCCU
ponAbe2     UGUCAGGAGCCACCUUCCGAGCCUCCAGUACCACGUGUCAGG-GCCACAUGAGCUGGGCCUCGUGGGCCU
gorGor1     -----------ACCUUCCGAGCCUCCAGUACCACGUGUCAGG-GCCACAUGAGCUGGGCCUCGUGGGCCU
calJac1     UGUCAGGAGCCACCUUCUGAGCCUCCAGUACCAUGUGUCAGG-ACCACAUGAACUGGGCAUUGUGGGCCU
panTro2     UGUCAGGAGCCACCUUCCGAGCCUCCAGUACCACGUGUCAGG-GCCACAUGAGCUGGGCCUCGUGGGCCU
dipOrd1     UGUCAGAAGCCACCUUCUGUGCCCCCAGCACCACGUGUCUGG-GCCACGUGAGCACGGCCACGUGGGCCU
mm9         UGUCAGAAGCCACCUUCUGUGCCCCCAGCACCACGUGUCUGG-GCCACGUGAGCAACGCCACGUGGGCCU
rn4         UGUCAGAAGCCACCUUCUGUGCCCCCAGCACCACGUGUCUGG-GCCACGUGAGCAACGCCACGUGGGCCU
bosTau4     UGUCAGGAGCUCCCUUCCCUGCCUCCAGUGCCAUGUGUCCGG-GCCAUGUGAGCAGAGCUUUGUGGGCCU
equCab2     UGUCAGGAGCCCCCUUCCGUGCCUCCAGCACCACGUGUCUGG-GCCAUGUGAGCAAGGUCACAUGGGCCC
felCat3     UGUCAGGAGCCCCCUUCUCUGCCUCCAGUACCACGUGUCUGGGGCCACAUGGGCCUGC------------
canFam2     UGUCAGGAGCCCC------------CCAUACCACGUGUCUGG-GCCACGUGAGCCCAU------------
pteVam1     ugucaggagCCCCCUUCGGUGCCUGUGGCACCGUGUGUUUGG-GCCACAUGGACCAUG------------
turTru1     ---------------------------GUGCCACGUGUCUGG-GCCACGUGAGCAGGG------------
SS anno     .(((.((((((.....(.(((.(((((((((((((..(((((..(((((((........))))))).)))
pair symbol  abc defghi     j klm nopqrstuvwxyz  ABCDE  FGHIJKL        LKJIHGF EDC

offset      7         8         9         0         1         2         3
FR266414    GAUGUGGUGC-UGGGG-CCUCAGGGGUCUGCUCUUCUUCUCUUUCAGAAUCU-GGGGCUCCAGGC--U
rheMac2     GAUGUGGUGC-UGGGG-CCUCAGGGGUCUGCUCUUCUCCUCUUUCAGAAUCU-GGGGCUGCAGGC--U
ponAbe2     GAUGUGGUGC-UGGGG-CCUCAGGGGUCUGCUCUUCUUCUCUUUCAGAAUCU-GGGGCUCCAGGC--U
gorGor1     GAUGUGGUGC-UGGGG-CCUCAGGGGUCUGCUCUUCUUCUCUUUCAGAAUCU-GGGGCUCCAGGC--U
calJac1     GACAUGGUGC-UGGGG-CCUCAGGGGUCUGCUCUUCUCCUCUUUCAGAAUCU-GGGGCUCCAGGC--U
panTro2     GAUGUGGUGC-UGGGG-CCUCAGGGGUCUGCUCUUCUUCUCUUUCAGAAUCU-GGGGCUCCAGGC--U
dipOrd1     GACGUGGGGC-UAGGG-CCGCAGGGGUCUGCAGGCCACCUCUUUCAGAAUCU-GGGGCUCCAGGC--C
mm9         GACGUGGAGC-UGGGG-CCGCAGGGGUCUGAUGGCCUCCUGUUUCAGAAUCU----------GG----
rn4         GACGUGGAGC-UGGGG-CCGCAGGGGUCUGAUGGCCUCCUGUUUCAGAAUCU-GGGGUUCCAGGC--U
bosTau4     GAGGUGGCUC-UGGGG-CUUCAGGGCUCUGCUGU-CUUCUCUUUUGGAAUCU-GGGGGCCCGGGU--U
equCab2     GAUGUGGUGC-UGGGGGCGGCAGGGCUCUGCUCUUCUCUUCUUUUGGAGUCUGGGGGCUUCGCAC--U
felCat3     ------GUGA-UGGGG-CUGCAGGCCUCUGCUCUCCUCCUCUUUAGGAAUCUGGAGGCUCCAGGC--U
canFam2     ------GUGU-UGGGA-CUGUAGGGCUCCGCUCUCCUCCUCUUUAGGAUCUG-GGGGCUCUGGGC--U
pteVam1     ------GUGC-UGGGG-CCACAGGGCUCUGCCCUUGUU--CUUGUAGAGCCA-GGGGCUCCGGGC--U
turTru1     ------CCUCGUGGGC-CUGA---------------------GGUGGCGCUG-GGGCUUCAGGGCUCU
SS anno     )))))))))).)))))..))).)................................)))))).)))...
pair symbol BAzyxwvuts rqpon  mlk j                                ihgfed cba   

[Return]