fRNAdb - Detail Page [FR274411]

Summary
ID	FR274411
Description	Histone 3' untraslated region (UTR) stem-loop
Accession	AC093350 , AC125099 , AF531306 , AL590614 , AY158915 , AY158941 , AY158955 , BC065803 , U62675
Sequence Ontology	three_prime_UTR
Organism
Homo sapiens	human , man
Mus musculus	LK3 transgenic mice , Mus muscaris , Mus sp. 129SV , house mouse , mice C57BL/6xCBA/CaJ hybrid , mouse , nude mice , transgenic mice
Genome Mapping
mouse(mm9) 2 regions	chr3:96073053-96073078(+)
chr13:22134347-22134372(-)
rat(rn3) 1 region	chr2:191044636-191044661(+)
Cross Reference
Rfam v8.1	RF00032
Sequence Similarity
highly similar	FR138456 Histone 3' untraslated region (UTR) stem-loop

Reference
Formation of the 3' end of histone mRNA. Dominski Z. and Marzluff WF. Gene 239 (1), 1-14 (1999) The sequence of the stem and flanking sequences at the 3' end of histone mRNA are critical determinants for the binding of the stem-loop binding protein. Williams AS. and Marzluff WF. Nucleic Acids Res 23 (4), 654-62 (1995)

Evidence :

Evidence Secondary Structure [putative(Rfam)]

Putative secondary structure predicted by Rfam.

0         1         2
ACAAAGGCUCUUUUCAGAGCCACCUA
.....((((((....)))))).....