FR325937

[Return]
  • Summary
  • Sequence
  • Secondary Structure

Evidence Secondary Structure [putative(CentroidFold)]
Putative secondary structure predicted by CentroidFold(-g=4).

Click here to view the PDF file.

0         1         2         3         4         5         6
UCCAGGUCAGGAGCCACUUGCCACCCUGCACACUGGCCUGCUGUGCCCCACCCUCUGCUUGCCCUCUGAC
....(((((((.(..............(((((.........)))))...............)..))))))

7
CC
).

[Return]