FR331486
- Summary
- Sequence
- Secondary Structure
| Summary | |
|---|---|
| ID | FR331486 |
| Description | Piwi-interacting RNA (piRNA) |
| Accession | DQ597703 |
| Sequence Ontology | piRNA |
| Organism | |
| Genome Mapping | |
| human(hg18) 17 regions | chr15:98157494-98157771(-)  |
| chr15:100111137-100111167(+) |
|
| chr15:100111481-100111511(+) |
|
| chr15:100112007-100112037(+) |
|
| chr15:100112442-100112472(+) |
|
| chr15:100112968-100112998(+) |
|
| chr15:100113494-100113524(+) |
|
| chr15:100114446-100114476(+) |
|
| chr15:100114972-100115002(+) |
|
| chr15:100115401-100115431(+) |
|
| chr15:100115836-100115866(+) |
|
| chr15:100119584-100119614(+) |
|
| chr15:100120480-100120510(+) |
|
| chr15:100121097-100121127(+) |
|
| chr15:100121532-100121562(+) |
|
| chr15:100122058-100122088(+) |
|
| chr15:100122311-100122341(+) |
|
| Cross Reference | |
| Sequence Similarity | |
| Reference | |
|---|---|
|
A germline-specific class of small RNAs binds mammalian Piwi proteins.
Girard A.,Sachidanandam R.,Hannon GJ. and Carmell MA. Nature 442 (7099), 199-202 (2006)
RNAdb--a comprehensive mammalian noncoding RNA database.
Pang KC.,Stephen S.,Engström PG.,Tajul-Arifin K.,Chen W.,Wahlestedt C.,Lenhard B.,Hayashizaki Y. and Mattick JS. Nucleic Acids Res 33 (Database issue), D125-30 (2005) | |
A germline-specific class of small RNAs binds mammalian Piwi proteins.
Girard A.,Sachidanandam R.,Hannon GJ. and Carmell MA.
Nature 442 (7099), 199-202 (2006)
Girard A.,Sachidanandam R.,Hannon GJ. and Carmell MA.
Nature 442 (7099), 199-202 (2006)
RNAdb--a comprehensive mammalian noncoding RNA database.
Pang KC.,Stephen S.,Engström PG.,Tajul-Arifin K.,Chen W.,Wahlestedt C.,Lenhard B.,Hayashizaki Y. and Mattick JS.
Nucleic Acids Res 33 (Database issue), D125-30 (2005)
Pang KC.,Stephen S.,Engström PG.,Tajul-Arifin K.,Chen W.,Wahlestedt C.,Lenhard B.,Hayashizaki Y. and Mattick JS.
Nucleic Acids Res 33 (Database issue), D125-30 (2005)
>FR331486|DQ597703|Piwi-interacting RNA (piRNA)|piRNA|PIR58814 RNAdb v2.0|Homo sapiens|31nt GGAAGAAGAAGACACTCCTGGAGGAGTCGGC
Evidence : putative(CentroidFold)
Evidence Secondary Structure [putative(CentroidFold)]
Putative secondary structure predicted by CentroidFold(-g=4).
0 1 2 3 GGAAGAAGAAGACACUCCUGGAGGAGUCGGC .............(((((....)))))....
| Experiment | Method | Tissue | Read Number | PubMed |
|---|