FR356277
- Summary
- Sequence
- Secondary Structure
| Summary | |
|---|---|
| ID | FR356277 |
| Description | C/D box guide small nucleolar RNA (snoRNA) HBII-419 / SNORD98 |
| Accession | AL513534 |
| Sequence Ontology | C_D_box_snoRNA |
| Organism | |
| Genome Mapping | |
| human(hg18) 1 region | chr10:70184935-70185001(+)  |
| Cross Reference | |
| Gene Association / Sense Overlap / Intron | |
| human(hg18) | CCAR1 (uc001jol.1 , uc001jom.1 , uc001jon.1 , uc001joo.1 , uc009xpx.1 ) |
| Gene Association / Sense Overlap / 3'UTR | |
| human(hg18) | NR_003076 (uc001jop.1 ) |
| Sequence Similarity | |
| OMIM | ||
|---|---|---|
| ID | Title | Locus |
| 612569 | CELL DIVISION CYCLE AND APOPTOSIS REGULATOR 1; CCAR1 CELL CYCLE AND APOPTOSIS REGULATORY PROTEIN 1; CARP1 |
10q21.3(chr10:64800001-71300000) |
| MicroArray / Invitrogen Ncode Noncoding RNA Array / hg18 | ||
|---|---|---|
| Probe | Target Transcript | Probe Locus |
| IVGNh26578 | UC001JOP |
chr10:70184934-70184994(+) |
| Reference | |
|---|---|
|
snoRNA-LBME-db, a comprehensive database of human H/ACA and C/D box snoRNAs.
Lestrade L. and Weber MJ. Nucleic Acids Res 34 (Database issue), D158-62 (2006)
RNAdb--a comprehensive mammalian noncoding RNA database.
Pang KC.,Stephen S.,Engström PG.,Tajul-Arifin K.,Chen W.,Wahlestedt C.,Lenhard B.,Hayashizaki Y. and Mattick JS. Nucleic Acids Res 33 (Database issue), D125-30 (2005)
Purified box C/D snoRNPs are able to reproduce site-specific 2'-O-methylation of target RNA in vitro.
Galardi S.,Fatica A.,Bachi A.,Scaloni A.,Presutti C. and Bozzoni I. Mol Cell Biol 22 (19), 6663-8 (2002)
RNomics: an experimental approach that identifies 201 candidates for novel, small, non-messenger RNAs in mouse.
Hüttenhofer A.,Kiefmann M.,Meier-Ewert S.,O'Brien J.,Lehrach H.,Bachellerie JP. and Brosius J. EMBO J 20 (11), 2943-53 (2001)
The numerous modified nucleotides in eukaryotic ribosomal RNA.
Maden BE. Prog Nucleic Acid Res Mol Biol 39 (), 241-303 (1990) | |
snoRNA-LBME-db, a comprehensive database of human H/ACA and C/D box snoRNAs.
Lestrade L. and Weber MJ.
Nucleic Acids Res 34 (Database issue), D158-62 (2006)
Lestrade L. and Weber MJ.
Nucleic Acids Res 34 (Database issue), D158-62 (2006)
RNAdb--a comprehensive mammalian noncoding RNA database.
Pang KC.,Stephen S.,Engström PG.,Tajul-Arifin K.,Chen W.,Wahlestedt C.,Lenhard B.,Hayashizaki Y. and Mattick JS.
Nucleic Acids Res 33 (Database issue), D125-30 (2005)
Pang KC.,Stephen S.,Engström PG.,Tajul-Arifin K.,Chen W.,Wahlestedt C.,Lenhard B.,Hayashizaki Y. and Mattick JS.
Nucleic Acids Res 33 (Database issue), D125-30 (2005)
Purified box C/D snoRNPs are able to reproduce site-specific 2'-O-methylation of target RNA in vitro.
Galardi S.,Fatica A.,Bachi A.,Scaloni A.,Presutti C. and Bozzoni I.
Mol Cell Biol 22 (19), 6663-8 (2002)
Galardi S.,Fatica A.,Bachi A.,Scaloni A.,Presutti C. and Bozzoni I.
Mol Cell Biol 22 (19), 6663-8 (2002)
RNomics: an experimental approach that identifies 201 candidates for novel, small, non-messenger RNAs in mouse.
Hüttenhofer A.,Kiefmann M.,Meier-Ewert S.,O'Brien J.,Lehrach H.,Bachellerie JP. and Brosius J.
EMBO J 20 (11), 2943-53 (2001)
Hüttenhofer A.,Kiefmann M.,Meier-Ewert S.,O'Brien J.,Lehrach H.,Bachellerie JP. and Brosius J.
EMBO J 20 (11), 2943-53 (2001)
The numerous modified nucleotides in eukaryotic ribosomal RNA.
Maden BE.
Prog Nucleic Acid Res Mol Biol 39 (), 241-303 (1990)
Maden BE.
Prog Nucleic Acid Res Mol Biol 39 (), 241-303 (1990)
>FR356277|AL513534|C/D box guide small nucleolar RNA (snoRNA) HBII-419 / SNORD98|C_D_box_snoRNA|RF00607 Rfam v8.1,SNO1289 RNAdb v2.0,HBII-419 snoRNA-LBME-db release3|Homo sapiens|67nt GAGTTATGATGTGTGTAAATCCTATTCCATTGCTGAAATGCAGTGTGGAACACAATGAACTGAACTC
Evidence : putative(Rfam)
Evidence Secondary Structure [putative(Rfam)]
Putative secondary structure predicted by Rfam.
0 1 2 3 4 5 6 GAGUUAUGAUGUGUGUAAAUCCUAUUCCAUUGCUGAAAUGCAGUGUGGAACACAAUGAACUGAACUC ((((...........................................................))))
| Experiment | Method | Tissue | Read Number | PubMed |
|---|