fRNAdb - Detail Page [FR375160]

Evidence Mapping [seqmap]

seqmap with no-mismatch, no-gap and no-repeat

Evidence Mapping [seqmap]

seqmap with no-mismatch, no-gap and no-repeat

Evidence Mapping [seqmap]

seqmap with no-mismatch, no-gap and no-repeat

Evidence Mapping [seqmap]

seqmap with no-mismatch, no-gap and no-repeat

Evidence Sequence Similarity [highly similar]

Almost same sequences with one mismatch or one gap

Summary
ID	FR375160
Description	Histone 3' untraslated region (UTR) stem-loop
Accession	AF397301 , AF531283 , AF531284 , AF531291 , AL031777 , AL512384 , AP001803 , BC096116 , BC096117 , BC096118 , BC096119 , Z80781 , Z83737 , Z98744
Sequence Ontology	three_prime_UTR
Organism
Homo sapiens	human , man
Genome Mapping
human(hg18) 4 regions	chr6:25835527-25835552(+)
	chr6:26360257-26360282(+)
	chr6:27966072-27966097(-)
	chr11:56279989-56280014(+)
Cross Reference
Rfam v8.1	RF00032
Sequence Similarity
highly similar	FR028070 Histone 3' untraslated region (UTR) stem-loop
highly similar	FR087493 Histone 3' untraslated region (UTR) stem-loop

OMIM
ID	Title	Locus
609904	HISTONE 1, H2BA; HIST1H2BA TESTIS-SPECIFIC HISTONE H2B; TSH2B	6p22.2(chr6:23500001-26100000)
602806	HISTONE 1, H2BH; HIST1H2BH H2B HISTONE FAMILY, MEMBER J; H2BFJ H2B/J	6p21.3(chr6:29900001-36800000)
602817	HISTONE 1, H3J; HIST1H3J H3 HISTONE FAMILY, MEMBER J; H3FJ H3/J	6p22-p21.3(chr6:15500001-36800000)

Reference
Formation of the 3' end of histone mRNA. Dominski Z. and Marzluff WF. Gene 239 (1), 1-14 (1999) The sequence of the stem and flanking sequences at the 3' end of histone mRNA are critical determinants for the binding of the stem-loop binding protein. Williams AS. and Marzluff WF. Nucleic Acids Res 23 (4), 654-62 (1995)

Evidence :

Evidence Secondary Structure [putative(Rfam)]

Putative secondary structure predicted by Rfam.

0         1         2
CCAAAGGCUCUUUUCAGAGCCACUUA
.....((((((....)))))).....