all 1 FR000001 75 TTGAGCCGTATGCGATGAAAGTTGCACGTACGGTTCTTTAAGGGGGAAAGTTTGAGAGGACCTACCTATCTTAAC Group II intron group II intron AB027356 Bonen L, Vogel J Group II introns have attracted considerable attention as ribozymes, mobile genetic elements and possible progenitors of nuclear spliceosomal introns. Major advances in understanding their catalytic structure and dispersal strategies have recently come from several model mitochondrial and bacterial self-splicing introns. In Nature, this family of introns shows wide variation in both features and behaviour, and this review includes a focus on the diversity of evolutionary pathways taken. Trends Genet, 17(6):322-31 34 Chu VT, Adamidi C, Liu Q, Perlman PS, Pyle AM The branch site of group II introns is typically a bulged adenosine near the 3'-end of intron domain 6. The branch site is chosen with extraordinarily high fidelity, even when the adenosine is mutated to other bases or if the typically bulged adenosine is paired. Given these facts, it has been difficult to discern the mechanism by which the proper branch site is chosen. In order to dissect the determinants for branch-point recognition, new mutations were introduced in the vicinity of the branch site and surrounding domains. Single mutations did not alter the high fidelity for proper branch-site selection. However, several combinations of mutations moved the branch site systematically to new positions along the domain 6 stem. Analysis of those mutants, together with a new alignment of domain 5 and domain 6 sequences, reveals a set of structural determinants that appear to govern branch-site selection by group II introns. EMBO J, 20(23):6866-76, 2001 12 8 Lehmann K, Schmidt U Group II introns are large, natural catalytic RNAs or ribozymes that were discovered in organelles of certain protists, fungi, algae, and plants and more recently also in prokaryotic organisms. In vitro, some members were found to self-splice from their pre-RNAs by two consecutive transesterification reactions joining the flanking exons and releasing the intron in a typical lariat form. Apart from self-splicing, a variety of other in vitro activities have been detected for group II introns demonstrating their amazing catalytic versatility. Group II introns fold into a conserved secondary structure consisting of six domains radiating from a central wheel that brings the 5' and 3' splice junction into close proximity. Domain 1 is the largest domain that is assumed to deliver the molecular scaffold assembling the intron in its active structure, while domain 5 is the phylogenetically most conserved part that represents the active site of the ribozyme. In vivo, the splicing reaction of many, if not all group II introns is assisted by proteins either encoded by the introns themselves (maturases), or encoded by other genes of the host organisms. The host proteins known to date have additional cellular functions and seem to have been adapted for splicing during evolution. Some of the protein-encoding group II introns were also shown to act as mobile genetic elements. They can integrate efficiently into intronless alleles of the same gene (homing) and at much lower frequencies into ectopic sites (transposition). The mobility process depends on intron encoded protein functions (endonuclease and reverse transcriptase) and on the intron RNA. This review provides a comprehensive survey of the structure/function relationships and the reaction potential of group II introns, the structurally most complicated, but also most fascinating ribozymes when looking at their catalytic repertoire in vitro and in vivo. Crit Rev Biochem Mol Biol, 38(3):249-303 15