Personal tools
You are here: Home fRNAdb: A comprehensive non-coding RNA sequence database doc fRNAdb::API

fRNAdb::API



Introduction

fRNAdb API is a web service using fRNAdb via an application program. fRNAdb API provides search and data retrieval services via REST and SOAP services. The REST service can be accessed using HTTP GET method and the SOAP service can be accessed using HTTP POST method.



REST Service

If you want to search using the keyword "miRNA", you access the following URL via your web browser:

http://www.ncrna.org/frnadb/api/search/miRNA

You can also use a more complex query that combines terms, operators, and parentheses (see fRNAdb API Query Syntax). You will receive the following XML response.

<?xml version="1.0" encoding="UTF-8"?>
<result version="3.0" xmlns="http://www.ncrna.org/frnadb/api/XMLSchema/search">
  <query>
    <offset>0</offset>
    <limit>100</limit>
    <query_string>miRNA</query_string>
  </query>
  <count>70110</count>
  <entry_list next="http://www.ncrna.org/frnadb/api/search/miRNA/100,100">
    <entry id="FR000003" link="http://www.ncrna.org/frnadb/api/entry/FR000003" />
       :
    <entry id="FR000608" link="http://www.ncrna.org/frnadb/api/entry/FR000608" />
  </entry_list>
</result>

Hit count is found between <count>tag, value is 70,110.

Hit entries are listed between <entry_list>tag. If hit count is more than 100, only first 100 entries are returned. Next 100 entries are returned by next request:

http://www.ncrna.org/frnadb/api/search/miRNA/100,100

Response details are described in fRNAdb API Response.

The REST service provides the following API. The API response is in XML.

URL Description Response
BaseURL/search/query Returns hit count and hit entry list (only first 100 entries). Search Response
BaseURL/search/query/offset,limit Returns hit count and hit entry list. Entry list range can be requested by offset and limit.
offset=100, limit=100 → 101-200th entries
Default value of limit is 100. Max value of limit is 5000.
Search Response
BaseURL/search/query/count Returns only hit count. Search Response
BaseURL/entry/EntryID Returns all features of requested entry. Entry Response
BaseURL/entry/EntryID/feature Returns only requested feature of requested entry. Entry Response
BaseURL/entry/EntryID/map/info Returns genome list. Listed genomes have map feature of requested entry. Genome Response
BaseURL/entry/EntryID/map/genome Returns map feature of requested entry for requested genome. Entry Response
BaseURL : http://www.ncrna.org/frnadb/api


Feature details are described in fRNAdb API Entry Feature

For several features, a non-XML response can be requested.


Available URL is as following.

URL Format
BaseURL/entry/EntryID/map/genome.gff Sanger Institute GFF
BaseURL/entry/EntryID/map/genome.bed UCSC BED
BaseURL/entry/EntryID/seq.fasta NCBI FASTA



REST Example


Request URL Sample
Database search http://www.ncrna.org/frnadb/api/search/miRNA
Database search (offset,limit requested) http://www.ncrna.org/frnadb/api/search/miRNA/101,100
Database search (return only hit count) http://www.ncrna.org/frnadb/api/search/miRNA/count
Entry retrieval (all feature) http://www.ncrna.org/frnadb/api/entry/FR000001
Entry retrieval (seq feature) http://www.ncrna.org/frnadb/api/entry/FR000001/seq
Entry retrieval (FASTA formated sequence) http://www.ncrna.org/frnadb/api/entry/FR000001/seq.fasta
Entry retrieval (mapped genome list) http://www.ncrna.org/frnadb/api/entry/FR000120/map/info
Entry retrieval (map feature) http://www.ncrna.org/frnadb/api/entry/FR000120/map/hg18
Entry retrieval (GFF formated map feature) http://www.ncrna.org/frnadb/api/entry/FR000120/map/hg18.gff
Entry retrieval (BED formated map feature) http://www.ncrna.org/frnadb/api/entry/FR000120/map/hg18.bed



SOAP Service

You can use the search and data retrieval services with SOAP.

The SOAP clients Perl, Python, Ruby and Java are supported.

For Perl, as an example, install the SOAP::Lite module (and other required modules) and write a client script to call the SOAP service.

The script must include the WSDL specification and some of following methods.

Method Parameters Description
search_count query_string Returns only hit count.
search query_string,
offset,
limit
Returns hit count and hit entry list.
Set region with offset and limit.
offset=100, limit=100 → 101-200 entries .
Default value of limit is 100. Max value of limit is 5000.
entry query_string,
feature,
map_genome
Returns features of requested entry. Either all features or a requested feature.
Feature details are described in fRNAdb API Entry Feature.
NOTE: 'map_genome' limits mapping information to a specific genome.
'map_genome' can have a value only when 'feature' is "map".
(the SOAPFault is triggered when 'map_genome' has a value and 'feature' is not "map".)
entry_mapinfo query_string,
genome
Returns genome list for requested entry map. Either all genomes or a requested genome.

Response of SOAP is almost the same as that of REST. There are no REST-links (like next attribute of <entry_list> element). See Entry Response.

Only XML format is supported.



SOAP Example (Perl)

Here is sample Perl codes with SOAP::Lite.

sample1.pl

#!/usr/bin/perl

# Fetch number of IDs whose organism is "human"

use SOAP::Lite;

$wsdl = "http://www.ncrna.org/frnadb/doc/soap.wsdl";
$serv = SOAP::Lite
  ->service($wsdl)
  ->outputxml(1);

$query_string = "org=human";

$d = SOAP::Custom::XML::Deserializer->deserialize($serv->search_count($query_string));
if ($d->valueof('//Fault/faultcode')) {
  print "### SOAP FAULT !!!\n";
  print " faultcode:   ", $d->valueof('//Fault/faultcode'), "\n";
  print " faultstring: ", $d->valueof('//Fault/faultstring'), "\n";
  print " detail:      ", $d->valueof('//Fault/detail'), "\n";
} else {
  print "count = ", $d->valueof('//result/count'), "\n";
}

exit(0);
shell> perl sample1.pl
count = 126672

sample2.pl

#!/usr/bin/perl

# Fetch 10 IDs whose organism is "human"

use SOAP::Lite;

$wsdl = "http://www.ncrna.org/frnadb/doc/soap.wsdl";
$serv = SOAP::Lite
  ->service($wsdl)
  ->outputxml(1);

$query_string = "org=human";
$offset = 0;
$limit = 10;

$d = SOAP::Custom::XML::Deserializer->deserialize($serv->search($query_string,$offset,$limit));
if ($d->valueof('//Fault/faultcode')) {
  print "### SOAP FAULT !!!\n";
  print " faultcode:   ", $d->valueof('//Fault/faultcode'), "\n";
  print " faultstring: ", $d->valueof('//Fault/faultstring'), "\n";
  print " detail:      ", $d->valueof('//Fault/detail'), "\n";
} else {
  for $t ($d->valueof('//result/entry_list/entry')) {
    print "entry.id = ", $t->attr->{'id'}, "\n";
  }
}

exit(0);
shell> perl sample2.pl
entry.id = FR000003
entry.id = FR000009
entry.id = FR000010
entry.id = FR000012
entry.id = FR000015
entry.id = FR000020
entry.id = FR000021
entry.id = FR000023
entry.id = FR000026
entry.id = FR000027

sample3.pl

#!/usr/bin/perl

# Fetch description of fRNAdbID:FR000001

use SOAP::Lite;

$wsdl = "http://www.ncrna.org/frnadb/doc/soap.wsdl";
$serv = SOAP::Lite
  ->service($wsdl)
  ->outputxml(1);

$query_string = "FR000001";
$feature = "";
$map_genome = "";

$d = SOAP::Custom::XML::Deserializer->deserialize($serv->entry($query_string,$feature,$map_genome));
if ($d->valueof('//Fault/faultcode')) {
  print "### SOAP FAULT !!!\n";
  print " faultcode:   ", $d->valueof('//Fault/faultcode'), "\n";
  print " faultstring: ", $d->valueof('//Fault/faultstring'), "\n";
  print " detail:      ", $d->valueof('//Fault/detail'), "\n";
} else {
  print "description = ", $d->valueof('//result/entry_list/entry/description'), "\n";
}

exit(0);
shell> perl sample3.pl
description = Group II intron

sample4.pl

#!/usr/bin/perl

# Fetch genomes to which fRNAdbID:FR000003 maps

use SOAP::Lite;

$wsdl = "http://www.ncrna.org/frnadb/doc/soap.wsdl";
$serv = SOAP::Lite
  ->service($wsdl)
  ->outputxml(1);

$query_string = "FR000003";
$genome = "";

$d = SOAP::Custom::XML::Deserializer->deserialize($serv->entry_mapinfo($query_string,$genome));
if ($d->valueof('//Fault/faultcode')) {
  print "### SOAP FAULT !!!\n";
  print " faultcode:   ", $d->valueof('//Fault/faultcode'), "\n";
  print " faultstring: ", $d->valueof('//Fault/faultstring'), "\n";
  print " detail:      ", $d->valueof('//Fault/detail'), "\n";
} else {
  for $t ($d->valueof('//result/entry_list/entry/genome_list/genome')) {
    print "genome.name = ", $t->attr->{'name'}, "\n";
  }
}

exit(0);
shell> perl sample4.pl
genome.name = hg17
genome.name = hg18


SOAP Example (Python)

Here is sample Python codes with SOAPpy.

sample1.py

#!/usr/bin/python

# Fetch number of IDs whose organism is "human"

from SOAPpy import WSDL

wsdl = "http://www.ncrna.org/frnadb/doc/soap.wsdl"
serv = WSDL.Proxy(wsdl)
result = serv.search_count(query_string="org=human")

print "count = " + result['count']
shell> python sample1.py
count = 126672

sample2.py

#!/usr/bin/python

# Fetch 10 IDs whose organism is "human"

from SOAPpy import *
from StringIO import StringIO
import sys, xml.parsers.expat

Config.dumpSOAPIn = 1

buf = StringIO()
sys.stdout = buf

wsdl = "http://www.ncrna.org/frnadb/doc/soap.wsdl"
serv = WSDL.Proxy(wsdl)
try:
  result = serv.search(query_string="org=human", offset=0, limit=10)
except:
  sys.stderr.write("Error\n")
else:
  sys.stdout = sys.__stdout__
  buf = buf.getvalue()
  buf = buf.strip()
  lines = buf.split('\n')
  lines = lines[1:-1]

  def start_element(name, attrs):
    if name == 'fs:entry':
      print "entry.id = " + attrs['id']

  p = xml.parsers.expat.ParserCreate()
  p.StartElementHandler  = start_element
  p.Parse(''.join(lines))
shell> python sample2.py
entry.id = FR000003
entry.id = FR000009
entry.id = FR000010
entry.id = FR000012
entry.id = FR000015
entry.id = FR000020
entry.id = FR000021
entry.id = FR000023
entry.id = FR000026
entry.id = FR000027

sample3.py

#!/usr/bin/python

# Fetch description of fRNAdbID:FR000001

from SOAPpy import WSDL

wsdl = "http://www.ncrna.org/frnadb/doc/soap.wsdl"
serv = WSDL.Proxy(wsdl)
result = serv.entry(query_string="FR000001", feature="", map_genome="")

print "description = " + result['entry_list']['entry']['description']
shell> python sample3.py
description = Group II intron

sample4.py

#!/usr/bin/python

# Fetch genomes to which fRNAdbID:FR000003 maps

from SOAPpy import *
from StringIO import StringIO
import sys, xml.parsers.expat

Config.dumpSOAPIn = 1

buf = StringIO()
sys.stdout = buf

wsdl = "http://www.ncrna.org/frnadb/doc/soap.wsdl"
serv = WSDL.Proxy(wsdl)
try:
  result = serv.entry_mapinfo(query_string="FR000003", genome="")
except:
  sys.stderr.write("Error\n")
else:
  sys.stdout = sys.__stdout__
  buf = buf.getvalue()
  buf = buf.strip()
  lines = buf.split('\n')
  lines = lines[1:-1]

  def start_element(name, attrs):
    if name == 'fg:genome':
      print "genome.name = " + attrs['name']

  p = xml.parsers.expat.ParserCreate()
  p.StartElementHandler  = start_element
  p.Parse(''.join(lines))
shell> python sample4.py
genome.name = hg17
genome.name = hg18


SOAP Example (Ruby)

Here is sample Ruby codes with SOAP4R.

sample1.rb

#!/usr/bin/env ruby

# Fetch number of IDs whose organism is "human"

require 'soap/wsdlDriver'

wsdl = "http://www.ncrna.org/frnadb/doc/soap.wsdl"
serv = SOAP::WSDLDriverFactory.new(wsdl).create_rpc_driver
serv.generate_explicit_type = true

result = serv.search_count(query_string="org=human")
print "count = #{result['count']}\n"
shell> ruby sample1.rb
count = 126672

sample2.rb

#!/usr/bin/env ruby

# Fetch 10 IDs whose organism is "human"

require 'soap/wsdlDriver'

wsdl = "http://www.ncrna.org/frnadb/doc/soap.wsdl"
serv = SOAP::WSDLDriverFactory.new(wsdl).create_rpc_driver
serv.generate_explicit_type = true

result = serv.search(query_string="org=human", offset=0, limit=10)
for entry in result['entry_list']['entry']:
        attr = (entry.__xmlattr).to_a
        print "entry.id = #{attr[0][1]}\n"
end
shell> ruby sample2.rb
entry.id = FR000003
entry.id = FR000009
entry.id = FR000010
entry.id = FR000012
entry.id = FR000015
entry.id = FR000020
entry.id = FR000021
entry.id = FR000023
entry.id = FR000026
entry.id = FR000027

sample3.rb

#!/usr/bin/env ruby

# Fetch description of fRNAdbID:FR000001

require 'soap/wsdlDriver'

wsdl = "http://www.ncrna.org/frnadb/doc/soap.wsdl"
serv = SOAP::WSDLDriverFactory.new(wsdl).create_rpc_driver
serv.generate_explicit_type = true

result = serv.entry(query_string="FR000001", feature="", map_genome="")
desc = result['entry_list']['entry']['description']
print "description = #{desc}\n"
shell> ruby sample3.rb
description = Group II intron

sample4.rb

#!/usr/bin/env ruby

# Fetch genomes to which fRNAdbID:FR000003 maps

require 'soap/wsdlDriver'

wsdl = "http://www.ncrna.org/frnadb/doc/soap.wsdl"
serv = SOAP::WSDLDriverFactory.new(wsdl).create_rpc_driver
serv.generate_explicit_type = true

result = serv.entry_mapinfo(query_string="FR000003", genome="")
for genome in result['entry_list']['entry']['genome_list']['genome']:
        attr = (genome.__xmlattr).to_a
        print "genome.name = #{attr[0][1]}\n"
end
shell> ruby sample4.rb
genome.name = hg17
genome.name = hg18


SOAP Example (Java)

Here is sample Java codes with Apache Axis.
You may generate the java classes with WSDL2Java in Apache Axis.

NOTE: Please change String_Element Type to String Type.

shell> java org.apache.axis.wsdl.WSDL2Java -p frnadb http://www.ncrna.org/frnadb/doc/soap.wsdl

sample1.java

// Fetch number of IDs whose organism is "human"

import frnadb.*;
import org.apache.axis.types.*;

public class sample1 {

  public static void main(String[] args){
    try {

        FRNAdbServiceLocator  locator  = new FRNAdbServiceLocator();
        FRNAdbPort_PortType   serv     = locator.getfRNAdbPort();

        String query_string      = new String("org=human");
        SearchResult_TYPE result = new SearchResult_TYPE();
        result = serv.search_count(query_string);

        NonNegativeInteger count = result.getCount();
        System.out.printf("count = %d", count);
        System.out.println();

    } catch (Exception e) {
        e.printStackTrace();
    }
  }

}
shell> javac sample1.java
shell> java sample1
count = 126672

sample2.java

// Fetch 10 IDs whose organism is "human"

import frnadb.*;
import org.apache.axis.types.*;

public class sample2 {

  public static void main(String[] args){
    try {

        FRNAdbServiceLocator  locator  = new FRNAdbServiceLocator();
        FRNAdbPort_PortType   serv     = locator.getfRNAdbPort();

        String query_string       = new String("org=human");
        NonNegativeInteger offset = new NonNegativeInteger("0");
        NonNegativeInteger limit  = new NonNegativeInteger("10");
        SearchResult_TYPE result  = new SearchResult_TYPE();
        result = serv.search(query_string, offset, limit);

        SearchEntry_TYPE[] entry_list = result.getEntry_list();
        for(int i=0; i<java.lang.reflect.Array.getLength(entry_list); i++){
                System.out.printf("entry.id = %s", entry_list[i].getId());
                System.out.println();
        }

    } catch (Exception e) {
        e.printStackTrace();
    }
  }

}
shell> javac sample2.java
shell> java sample2
entry.id = FR000003
entry.id = FR000009
entry.id = FR000010
entry.id = FR000012
entry.id = FR000015
entry.id = FR000020
entry.id = FR000021
entry.id = FR000023
entry.id = FR000026
entry.id = FR000027

sample3.java

// Fetch description of fRNAdbID:FR000001

import frnadb.*;
import org.apache.axis.types.*;

public class sample3 {

  public static void main(String[] args){
    try {

        FRNAdbServiceLocator  locator  = new FRNAdbServiceLocator();
        FRNAdbPort_PortType   serv     = locator.getfRNAdbPort();

        String query_string     = new String("FR000001");
        String feature          = new String("");
        String map_genome       = new String("");
        EntryResult_TYPE result = new EntryResult_TYPE();
        result = serv.entry(query_string, feature, map_genome);

        Entry_TYPE[] entry_list = result.getEntry_list();
        String description = entry_list[0].getDescription();
        System.out.printf("description = %s", description);
        System.out.println();

    } catch (Exception e) {
        e.printStackTrace();
    }
  }

}
shell> javac sample3.java
shell> java sample3
description = Group II intron

sample4.java

// Fetch genomes to which fRNAdbID:FR000003 maps

import frnadb.*;
import org.apache.axis.types.*;

public class sample4 {

  public static void main(String[] args){
    try {

        FRNAdbServiceLocator  locator  = new FRNAdbServiceLocator();
        FRNAdbPort_PortType   serv     = locator.getfRNAdbPort();

        String query_string      = new String("FR000003");
        String genome            = new String("");
        GenomeResult_TYPE result = new GenomeResult_TYPE();
        result = serv.entry_mapinfo(query_string, genome);

        GenomeEntry_TYPE[] entry_list = result.getEntry_list();
        Genome_TYPE[] genome_list     = entry_list[0].getGenome_list();
        for(int i=0; i<java.lang.reflect.Array.getLength(genome_list); i++){
                System.out.printf("genome.name = %s", genome_list[i].getName());
                System.out.println();
        }

    } catch (Exception e) {
        e.printStackTrace();
    }
  }

}
shell> javac sample4.java
shell> java sample4
genome.name = hg17
genome.name = hg18


fRNAdb API Query Syntax

The service is query compliant with CQL-1.2.

Query is case-insensitive. "mirna and trna" and "MIRNA AND TRNA" are treated as a same query.



fRNAdb API Entry Feature


Feature Contents
desc Description
seq Nucleotide sequence
acc Genbank accession
org Organism
so SequenceOntology
pmid PubMed reference
xid CrossReference for entry itself (RNAdb, Rfam etc.)
assoc CrossReference to entry associated genes (OMIM, KEGG etc.)
map Genome mapping



fRNAdb API Response


  • Search Response
    NOTE: There is no 'next' attribute of <entry_list> element and no 'link' attribute of <entry> element for SOAP services.
    <?xml version="1.0" encoding="UTF-8"?>
    
    <result version="3.0" xmlns="http://www.ncrna.org/frnadb/api/XMLSchema/search">
    
      <!-- Requested query -->
      <query>
        <offset>0</offset>
        <limit>100</limit>
        <query_string>miRNA</query_string>
      </query>
    
      <!-- Hit count -->
      <count>70110</count>
    
      <!-- Hit entry list -->
      <entry_list next="http://www.ncrna.org/frnadb/api/search/miRNA/100,100">
        <entry id="FR000003" link="http://www.ncrna.org/frnadb/api/entry/FR000003"/>
       :
        <entry id="FR000608" link="http://www.ncrna.org/frnadb/api/entry/FR000608"/>
      </entry_list>
    
    </result>
    
  • Entry Response
    <?xml version="1.0" encoding="UTF-8"?>
    
    <!-- This is nonexistent data. -->
    
    <result version="3.0" xmlns="http://www.ncrna.org/frnadb/XMLSchema/entry">
    
      <!-- Requested query -->
      <query>
        <feature>all</feature>
        <entry_num>1</entry_num>
        <entry_string>FR000000</entry_string>
      </query>
    
      <entry_list>
    
        <entry id="FR000000">
    
          <length>22</length>
          <sequence>CATGCCTTGAGTGTAGGACCGT</sequence>
          <description>mature micro RNA (miRNA) miR-532-5p or Piwi-interacting RNA (piRNA)</description>
    
          <ontology>
            <sequence_ontology id="SO:0001035" name="piRNA" version="2.3">
              <synonym>piwi-associated RNA</synonym>
            </sequence_ontology>
            <sequence_ontology id="SO:0000276" name="miRNA" version="2.3">
              <synonym>micro RNA</synonym>
              <synonym>microRNA</synonym>
              <synonym>micro</synonym>
            </sequence_ontology>
          </ontology>
    
          <organism>
            <ncbi_taxonomy  id="9913"  name="Bos taurus">
              <synonym>Bos bovis</synonym>
              <synonym>Bos primigenius taurus</synonym>
              <synonym>bovine</synonym>
              <synonym>cattle</synonym>
              <synonym>cow</synonym>
              <synonym>domestic cattle</synonym>
              <synonym>domestic cow</synonym>
            </ncbi_taxonomy> 
            <ncbi_taxonomy  id="9606"  name="Homo sapiens">
              <synonym>human</synonym>
              <synonym>man</synonym>
            </ncbi_taxonomy>
          </organism>
    
          <accession_list>
            <ncbi_genbank>DQ708952</ncbi_genbank>
            <ncbi_genbank>AF499825</ncbi_genbank>
          </accession_list>
    
          <reference>
            <ncbi_pubmed id="15199136">
              <title>Human box H/ACA pseudouridylation guide RNA machinery.</title>
              <authors>Kiss AM, Jady BE, Bertrand E, Kiss T</authors>
              <abstract>Pseudouridine, the most abundant modified nucleoside in RNA, is ... </abstract>
              <issue>Mol Cell Biol, 24(13):5797-807, 2004 Jul</issue>
              <cited_num>11</cited_num>
            </ncbi_pubmed>
          </reference>
    
          <!-- Cross Reference for entry itself -->
          <cross_reference>
            <link to="RNAdb"    id="PIR217600"     version="2.0" />
            <link to="miRBase"  id="MIMAT0003848"  version="9.2" />
            <link to="miRBase"  id="MIMAT0002888"  version="9.2" />
            <link to="miRBase"  id="MIMAT0002889"  version="9.2" />
          </cross_reference>
    
          <!-- Cross Reference to entry associated genes -->
          <gene_association>
            <link to="OMIM"    id="156240" />
            <link to="OMIM"    id="606613" />
          </gene_association>
    
          <!-- snoRNA specific Cross Reference -->
          <snorna_feature>
            <host_gene>RPL7A (ribosomal protein L7A)</host_gene>
            <target_rna>18S rRNA A668</target_rna>
            <overlapping_gene  genome="hg18" type="UCSC Gene"    name="uc001ape.1">
              <genomebrowser_link>URI</genomebrowser_link>
            </overlapping_gene>
            <overlapping_gene  genome="hg18" type="UCSC Gene"    name="uc001apf.1">
              <genomebrowser_link>URI</genomebrowser_link>
            </overlapping_gene>
            <overlapping_gene  genome="hg18" type="RefSeq Gene"  name="BC062342">
              <genomebrowser_link>URI</genomebrowser_link>
            </overlapping_gene>
            <overlapping_gene  genome="dm3"  type="FlyBase Gene" name="CG15442-RA">
              <genomebrowser_link>URI</genomebrowser_link>
            </overlapping_gene>
          </snorna_feature>
    
          <!-- mature micro RNA specific Cross Reference -->
          <mirna_feature>
            <precursor_mirna>
              <link to="miRBase" id="MI0003205" version="9.2" />
              <link to="miRBase" id="MI0003206" version="9.2" />
              <link to="miRBase" id="MI0005061" version="9.2" />
              <link to="fRNAdb"  id="FR212689"  version="3.0" />
              <link to="fRNAdb"  id="FR336718"  version="3.0" />
              <link to="fRNAdb"  id="FR060646"  version="3.0" />
            </precursor_mirna>
          </mirna_feature>
    
          <!-- Cross Reference to complementary sequence in fRNAdb -->
          <complementary_sequence>
            <link to="fRNAdb"   id="FR000000" version="3.0" />
          </complementary_sequence>
    
          <!-- Cross Reference to similar sequences in fRNAdb -->
          <highly_similar_sequence>
            <link to="fRNAdb"   id="FR000000" version="3.0" />
            <link to="fRNAdb"   id="FR000000" version="3.0" />
          </highly_similar_sequence>
    
          <!-- Genome mapping -->
          <map>
            <locus>
              <genome>hg17</genome>
              <cytoband>Xp11.23</cytoband>
              <chromosome>chrX</chromosome>
              <start>49470809</start>
              <end>49470830</end>
              <strand>+</strand>
              <exon_number>1</exon_number>
              <exon start="49470809" end="49470830" />
              <evidence>BLAT</evidence>
              <identity>100</identity>
              <genomebrowser_link>URI</genomebrowser_link>
            </locus>
          </map>
    
          <!-- Expression data (GEO) -->
          <expression>
            <tissue description="S2 cells, AGO2 IP" read_number="2" evidence="varidated">
              <ncbi_taxonomy  id="7227"  name="Drosophila melanogaster">
                <synonym>Drosophila melangaster</synonym>
                <synonym>fruit fly</synonym>
              </ncbi_taxonomy>
              <ncbi_pubmed id="16778019">
                <title>Characterization of the piRNA complex from rat testes.</title>
                <authors>Lau NC, Seto AG, Kim J, Kuramochi-Miyagawa S, Nakano T, Bartel DP, Kingston RE</authors>
                <abstract>Small noncoding RNAs regulate processes essential ... </abstract>
                <issue>Science, 313(5785):363-7, 2006 Jul, Epub 2006 Jun</issue>
                <cited_num>25</cited_num>
              </ncbi_pubmed>
              <link to="NCBI_GEO"      id="GSM280089" />
              <method>Illumina-Solexa</method>
              <experiment description="small RNAs"
                          authors="Czech B, Malone CD, Zhou R, Stark A, ... Hannon GJ, Brennecke J"
                          date="2008-04-30">
                <ncbi_taxonomy  id="7227"  name="Drosophila melanogaster">
                  <synonym>Drosophila melangaster</synonym>
                  <synonym>fruit fly</synonym>
                </ncbi_taxonomy>
                <link to="NCBI_GEO"      id="GSE11086" />
              </experiment>
            </tissue>
          </expression>
    
        </entry>
    
      </entry_list>
    
    </result>
    
  • Genome Response
    NOTE: There is no 'link' attribute of <genome> element for SOAP services.
    <?xml version="1.0" encoding="UTF-8"?>
    
    <result version="3.0" xmlns="http://www.ncrna.org/frnadb/XMLSchema/genome">
    
      <entry_list>
        <entry id="FR000000">
          <genome_list link="http://www.ncrna.org/frnadb/FR000000/map">
            <genome name="hg17" link="http://www.ncrna.org/frnadb/FR000000/map/hg17" />
            <genome name="hg18" link="http://www.ncrna.org/frnadb/FR000000/map/hg18" />
          </genome_list>
        </entry>
      </entry_list>
    
    </result>
    

Powered by Plone CMS, the Open Source Content Management System

This site conforms to the following standards: