Reference

Rchange: Algorithms for computing energy changes of RNA secondary structures in response to base mutations.
Hisanori Kiryu; Kiyoshi Asai, Bioinformatics 2012; doi: 10.1093/bioinformatics/bts097
[Abstract][PDF] [Supplementary text][Supplementary Dataset]

Rchange Source Code

Rchange C++ Source Code (zip compressed)

Readme File for Source Code (.txt file)

Description

Rchange exhaustively computes entropy and internal energy changes of secondary structures for single-point and double-point mutated sequences.

Install from source: (require make and (g++ or icpc))
$ unzip rchange-0_0_1.zip
$ cd rchange-0_0_1/src/
$ make
$ cd ..

Example:
$ ./src/rchange/run_rchange -outfile=./example/rchange_out.txt -command=compute_mut1 -seqfile=./example/seqs.fa -max_span=200 -max_mut2_span=10

options: -name=<type:default>	: description
-help=<bool:false>	: if true, print this help message and exit.
-outfile=<string:rentropy_out.txt>	: name of output file.
-command=<string:compute_mut1>	: 'compute_mut1' and 'compute_mut2' prints thermodynamic values for each single and double mutations, respectively.
-seqfile=<string:NO FILE>	: input file in fasta format.
-max_span=<int:10>	: maximal base pair span
-max_mut2_span=<int:10>	: maximal distance between pairs of mutations considered

Output Format:
A tab delimited format with a fasta-like header line for each sequence. Sequence positions of mutations (mut_pos1, mut_pos2) are in 0-based indexing convention. all the values are printed in unit of kcal/mol. In particular, entropies are printed as (- RT \sum P log P), where R=1.9872x10^{-3}[kcal/(mol K)] is gas constant, T=310.15[K] is temperature, and P is the Boltzmann probability distribution. Ensemble free energy is given by -RTlog(Z) where Z is the partition function.
------------------------------------
>sequence_name_1 # header line
mut_pos1 mut_pos2 original_base(s) mutation_data # 4 tab delimited columns for each row.
# There is a new line at the end of each table
>sequence_name_2
...
-------------------------------------

"mutation_data" is semicolon (';') delimited entries representing different mutations to the original base(s).
For each mutaion, there are 4 fields delimited by comma ',' representing
mutated_base(s),entropy_change,internal_energy_change,ensemble_free_energy_change;

mut_pos1 = mut_pos2 for single-point mutations

when mut_pos1 < 0, it represents thermodynamic variables of the original sequence as follows: -seq_len -seq_len N N:entropy:internal_energy:ensemble_free_energy

Output Example:
-----------------------------------------------------------------
>RF00005,tRNA,CP001399.1/1388256-1388329

-74	-74	N	N,3.22873,-38.609,-41.8378;
73	73	A	C,0.022292,0.918986,0.896694;G,4.38638e-08,4.16677e-08,-2.19609e-09;T,0.0058682,0.504981,0.499113;
72	72	C	G,0.0189808,3.31635,3.29737;T,0.253788,2.85822,2.60444;A,0.0189806,3.31635,3.29737;
.....
1	1	G	T,0.597295,7.34894,6.75165;A,0.616528,7.17693,6.5604;C,0.607786,7.25339,6.6456;
0	0	G	T,0.153886,4.32688,4.173;A,0.0712546,4.05877,3.98752;C,0.0692192,3.95708,3.88786;

>RF00001,5S_rRNA,X07545.1/505-619

-115	-115	N	N,2.13468,-73.104,-75.2387;
114	114	T	A,-0.0105533,-0.00903948,0.0015138;C,-0.0105501,-0.00903648,0.00151361;G,-0.0104647,-0.00895751,0.00150718;
113	113	A	C,0.0514393,0.741557,0.690118;G,0.0282833,-0.175106,-0.203389;T,0.328816,-0.0408454,-0.369661;
.....

Example

We compute thermodynamic changes for an Rfam sequence RF00005,tRNA,AL138651.1/64525-64597.

---

Content of input file trna.fa:
>RF00005,tRNA,AL138651.1/64525-64597
GGGGAUGUAGCUCAUAUGGUAGAGCGCUCGCUUUGCAUGCGAGAGGCACAGGGUUCGAUUCCCUGCAUCUCCA

---

Original tRNA structure predicted by CentroidFold (colors represent strengths of base pairing probabilities):

---

Apply Rchange with command:
$ run_rchange -outfile=rchange_out.txt -command=compute_mut1 -seqfile=trna.fa -max_span=400
We obtain rchange_out.txt

---

The upper bound (solid line) and lower bound (broken lines) of the relative changes dF/|F|, dU/|U|, dS/S for each position:

---

From the output file, we extract mutations that minimize or maximize the relative changes.

Type	Position(0-based)	From	To	Relative Change dX/|X|
Min dF/|F|	13	A	G	-0.17
Max dF/|F|	3	G	U	0.15
Min dU/|U|	13	A	G	-0.22
Max dU/|U|	70	C	A	0.19
Min dS/S	5	U	A	-0.50
Max dS/S	23	G	U	0.37

---

The predicted secondary structures of the original and the mutated sequences:
Original
GGGGAUGUAGCUCAUAUGGUAGAGCGCUCGCUUUGCAUGCGAGAGGCACAGGGUUCGAUUCCCUGCAUCUCCA
(((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))).


Min dF/|F|
GGGGAUGUAGCUCGUAUGGUAGAGCGCUCGCUUUGCAUGCGAGAGGCACAGGGUUCGAUUCCCUGCAUCUCCA
(((((((...((((((((.((((((....)))))))))))))).....(((((.......)))))))))))).


Max dF/|F|
GGGUAUGUAGCUCAUAUGGUAGAGCGCUCGCUUUGCAUGCGAGAGGCACAGGGUUCGAUUCCCUGCAUCUCCA
.........((((........))))..((((.......))))((((..(((((.......)))))..))))..


Min dU/|U|
GGGGAUGUAGCUCGUAUGGUAGAGCGCUCGCUUUGCAUGCGAGAGGCACAGGGUUCGAUUCCCUGCAUCUCCA
(((((((...((((((((.((((((....)))))))))))))).....(((((.......)))))))))))).


Max dU/|U|
GGGGAUGUAGCUCAUAUGGUAGAGCGCUCGCUUUGCAUGCGAGAGGCACAGGGUUCGAUUCCCUGCAUCUACA
.........((((........)))).(((((.......))))).....(((((.......)))))........


Min dS/S
GGGGAAGUAGCUCAUAUGGUAGAGCGCUCGCUUUGCAUGCGAGAGGCACAGGGUUCGAUUCCCUGCAUCUCCA
......((.((((........))))))((((.......))))((((..(((((.......)))))..))))..


Max dS/S
GGGGAUGUAGCUCAUAUGGUAGAUCGCUCGCUUUGCAUGCGAGAGGCACAGGGUUCGAUUCCCUGCAUCUCCA
((((((((...............((.(((((.......))))).))...((((.......)))))))))))).